package NGS::VEP;

# wrapper around Ensembl Variant Effect Predictor stand-alone script;
# http://www.ensembl.org/info/docs/variation/vep/vep_script.html

use Moo;
use IO::All;
use IO::File;
use Text::CSV;
use Sort::Naturally;
use Data::Dumper::Concise;
use Time::HiRes qw(gettimeofday tv_interval);

use FindBin qw($Bin); # warn $Bin;
use Modern::Perl '2012';

use NGS::MooX::Types qw(HashReference ArrayReference Object String);
use NGS::DB;

has errors => ( is => 'ro', isa => ArrayReference, default => sub { [] } );

# required to be passed on object contruction:
has form_opts => ( is  => 'ro', isa => HashReference, required => 1 );
has src_data  => ( is  => 'ro', isa => Object, required => 1 );
has config    => ( is  => 'ro', isa => HashReference, required => 1 );

# called internally by result():
has ref_table => ( is => 'lazy' ); # _build_ref_table()
has vep_input => ( is => 'lazy' ); # _build_vep_input()

# result counters:
has result_counter => ( is => 'lazy' ); # _build_result_counter() returns hashref
# locations table (include/exclude known start locations):
has known_locations => ( is => 'lazy' ); # _build_known_locations() returns hashref map

my %text_csv_args = ( sep_char => "\t", binary => 1 ); # global args for Text::CSV

# location of variable_effect_predictor script:
my $vep_script = "$Bin/../script/variant_effect_predictor.pl";

my $debug = new IO::File;
open ($debug, '>', "$Bin/../debug.txt") || die $!;
$debug->autoflush(1); # to get past opening pipe to vep script

use constant DEBUG => 1; # 1 (on), 0 (off) - also uses running env (requires devel)
# list of data items required for VEP script input file:
use constant VEP_FIELDS => qw(chromosome start_point end_point allele strand);

# ==============================================================================
sub roche_454 {
    my $self = shift; # warn Dumper $self->database;

# define vars ------------------------------------------------------------------
    # var: $src_data
    # extract tab-delimited data from NGS csv data file
    my $src_data = $self->_text_csv_slurp(); # warn Dumper $src_data; # arrayref

    # var: $header_row
	# remove 1st row (= headers) from $src_data
	my $header_row = shift @$src_data; # warn Dumper $header_row;

	# var: $hmds_ref_numbers
    # get hmds sample refs from header row - in cols starting at col #6
	my $hmds_ref_numbers = $self->_get_hmds_refs($header_row);

    # var: $ref_table
    # get chromosome & start points for exons - reference table from database
    my $ref_table = $self->ref_table; # warn Dumper $ref_table;

    # var: @vep_input
    # pre-processed data for VEP input; list of hashrefs with keys = VEP_FIELDS
    # of 'accepted' rows from src_data file
    my @vep_input;

    # var: %exon_data_ref
    # hash map; keys = unique_id (chromosome_start-base_variant, eg 2_123456_C/T);
	# vals = @vep_field vals (chr, start, end, etc); acts as ref data for merging
	# with VEP script output
    my %exon_data_ref;

	# var: %exon_names
	# hash of unique exon names - checks that all are parsed correctly and exist
	# in %exon_data_ref (may not if different exons produce identical unique ids)
	my %exon_names;

# run --------------------------------------------------------------------------
    # var: $row
    # each row in NGS csv data array, cols = exon name, base/variant, status, etc
    ROW: for my $row (@$src_data) { # warn Dumper $row;
		$self->result_counter->{src_rows}++; # warn Dumper $self->result_counter;
        # skip row unless 3rd col (status field) reads 'accepted'
        next ROW unless lc $row->[2] eq 'accepted';
		$self->result_counter->{accepted_src_rows}++; # warn Dumper $self->result_counter;

        # var: $exon_name
        # sequence name in 1st col eg ASXL exon 12.7, JAK2 exon 12.1
        my $exon_name = $row->[0]; # warn $exon_name;
		$exon_names{$exon_name}++;

        # var: $ref_data
        # reference data from database for exon name (skip row if no db entry)
        my $ref_data = $ref_table->{$exon_name}; # warn Dumper $ref_data;
        if (! $ref_data) {
			my $str = 'no ref table entry for ' . $exon_name;
			$self->_add_to_errors($str); # warn $str;
			next ROW;
        }

        # var: $chromosome
        # chromosome number for exon, derived from reference data
        my $chromosome = $ref_data->{chromosome};

        # var: $variant
        # 2nd col is colon-separated base location & variant (eg 136:A/T, 26-27:TG/--)
        my $variant = $row->[1]; # warn $variant;

        # fix for FLT3-ITD 1 variant i(278.5,TGAGATCATATTCATATTTGAGATCATATTCATATT):
        unless ( $variant =~ /:/ ) {
			my $str = sprintf 'cannot split %s variant %s', $exon_name, $variant;
			$self->_add_to_errors($str); # warn $str;
			next ROW;
        }

        # var: $location, $allele
        # split base location & variant from $variant (eg 136:A/T, 26-27:TG/--)
        my ($location, $allele) = split ':', $variant; # warn Dumper [$location, $allele];

        # var: $start_point, $end_point
        # define initial start & end points as reference data start position minus 1
        my $start_point = my $end_point = $ref_data->{start_base} - 1; # eg 125436276

        # if base location > 1 base (eg 26-27, 134-137, etc):
        if ( $location =~ /(\d+)-(\d+)/ ) { # warn $location; # eg 26-27
			my $span = $2 - $1; # eg 26-27 will give span = 1
            $start_point += $1; # ref tbl start pos + 1st capture (26 in above example)
            $end_point = $start_point + $span;
        }
        else {
            $end_point = $start_point += $location;
        } # warn Dumper [ $start_point, $end_point ];

        {
            # var: %h
            # hash data for vep script input file, keys = VEP_FIELDS
            my %h = (
                chromosome  => $chromosome,
                start_point => $start_point,
                end_point   => $end_point,
                allele      => $allele, # eg T/C, A/G, etc
                strand      => '+', # required 5th col in VEP file
            ); # warn Dumper \%h;
            push @vep_input, \%h;

			{ # add exon name and id unique identifier for $exon_data_ref (don't
				# want this in vep_input); exon name + variant/location = unique ID
				$h{exon_name} = $exon_name; # eg "TET2 exon 4"
				my $exon_id = sprintf '%s [%s]', $exon_name, $variant;
				$h{exon_id} = $exon_id; # eg "TET2 exon 4 [891:C/T]"
			}

            # var: $unique_id
            # create ID matching return from VEP script, created using combination
			# of chromosome, start base number & allele, eg 2_12345_C/G
            my $unique_id = join '_', $chromosome, $start_point, $allele;
            $exon_data_ref{$unique_id} = \%h;

            { # get patient results in cols 6 onwards:
				my $i = 0; # reset counter to 0
				for my $ref ( @$hmds_ref_numbers ) { # warn $ref;
                    # var: $result
					# percentage positive result - in 1st col of each sample ref pair
					my $result = $row->[5 + $i]; # warn $result; # col 6, 8, 10, etc
					if ( $result > 0 ) { # skip zero's
                        # var: $read_no
                        # read number - in 2nd col of each sample ref pair
						my $read_no = $row->[5 + $i + 1]; # col 7, 9, 11, etc

                        my %d = (
                            lab_no => $ref,
                            result => $result,
                            read   => $read_no,
                        ); # warn Dumper \%d;
                        # add sample data to $exon_data_ref{$unique_id} as array
                        # (to allow same location/allele to have multiple samples):
                        push @{ $exon_data_ref{$unique_id}{sample_data} }, \%d;
                    };
					$i += 2; # move 2 cols along
				}
			}
        }
    } #  warn Dumper \%exon_data_ref;
    $self->result_counter->{vep_input_rows} = scalar @vep_input;
    
	{ # check all exon names are included in %exon_data_ref:
		my @seen = map $exon_data_ref{$_}->{exon_name}, keys %exon_data_ref;
		# delete all 'seen' exon names:
		delete @exon_names{ @seen }; # warn Dumper \@seen;
		# add any missing exon names to errors:
		$self->_add_to_errors("$_ omitted from VEP input") for keys %exon_names;
	}

	# sort data into chromosome order to (possibly) speed up vep processing:
    my @vep_fields = VEP_FIELDS;
	for ( sort by_chr_location @vep_input ) {
		my $line = join "\t", @{$_}{@vep_fields}; # warn $line;
		io($self->vep_input)->append($line . "\n");
	}

	# send to function running VEP script:
    
    # var: $result
    # hashref of output data from VEP script (consequence, amino_acids,
    # sift, polyphen, etc), results of patient samples & non-cds rows
	my $result = $self->_run_vep(\%exon_data_ref);
    { # add counts, errors, etc:
        my %h = (
            counts => $self->result_counter, # add result counters
            errors => $self->errors,
        );
        $result->{data} = \%h;
    }

	io($self->vep_input)->unlink || die "cannot unlink vep_input - $!";
	return $result;
}

#-------------------------------------------------------------------------------
sub miseq_vcf {
    my $self = shift;
    my $args = shift; # href outdir = str, files = array(ref)
    
    my $files   = $args->{files};
    my $tmp_dir = $args->{outdir}; # location of extracted files in /tmp

    # miseq run id = sub-directory name in /tmp dir (remove leading /tmp/):
    # my $miseq_id = substr($tmp_dir, 5); # warn $miseq_id; # not using
    
    my @vep_fields = VEP_FIELDS;

    # var: %exon_data_ref
    # hash map; keys = unique_id (chromosome_start-base_variant, eg 2_123456_C/T);
	# vals = @vep_field vals (chr, start, end, etc); acts as ref data for merging
	# with VEP script output
    my %exon_data_ref = ();

    my @vep = (); # reset array - to hold rows for vep input file
    my %seen; # to ensure unique gene/chromosome/start_point/allele combinations in vep

	FILE: for (@$files) { # warn $_;
        my $io = io($_);
        
        my $file = $io->filename; # warn $file;
		next FILE unless $file =~ /vcf\Z/; # skip unless .vcf suffix
        # my $sample_id = join '/', $miseq_id, $file; # warn $sample_id; # not using
        
        my $lab_number = join '/', $file =~ /^[A-Z]?(\d+)-(\d+)/; # warn $lab_number;
        
		my $data = $self->_parse_file($io); # warn Dumper $data; # AoH
        ROW: for my $row (@$data) { # warn Dumper $row; # hashref
            # create unique id:
            my $unique_id = join '_', @{$row}{qw(chromosome start_point allele)};

            # use gene name + unique_id as alias for exon_id (exon_id not supplied by miseq):
            my $exon_id_alias = join '_', $row->{gene}, $unique_id;
            $row->{exon_id} = $exon_id_alias; # warn $exon_id_alias;

            # add vcf data to %exon_data_ref under unique_id key (unless already exists):
            unless ( $exon_data_ref{$unique_id} ) {
                my %h = map +( $_ => $row->{$_} ),
                    qw(chromosome start_point end_point allele exon_id);
                $exon_data_ref{$unique_id} = \%h;
            }

            { # add sample data to $exon_data_ref{$unique_id} sample_data array;
              # array allows multiple samples to have same location/allele:
                my %d = (
                    lab_no => $lab_number,
                    result => $row->{vf},
                    read   => $row->{depth},
                ); # warn Dumper \%d;
                push @{ $exon_data_ref{$unique_id}{sample_data} }, \%d;
            }
            # only need each variant once in vep input:
            next ROW if $seen{$exon_id_alias}++;
            push @vep, [ @{$row}{@vep_fields} ];
        }
	}
    $self->result_counter->{vep_input_rows} = scalar @vep;
    $self->_debug(exon_data_ref => \%exon_data_ref); # warn Dumper \%seen;

# send to function running VEP script:
    # write out vars as tab-delimited row to vep input file, Sort::Naturally by chr:
=begin # this block will split vep input into separate chromosome inputs:
    for my $ref ( sort by_chromosome_and_start_pos @vep ) {
        my $row = join "\t", @$ref;
        my $chr = $ref->[0]; # warn $chr;
        my $file = join '_', $self->vep_input, $chr; # warn $file;
        io($file)->append($row . "\n");
    }
=cut
    for my $ref ( sort by_chromosome_and_start_pos @vep ) { 
        my $row = join "\t", @$ref;
        io($self->vep_input)->append($row . "\n");
    }

    # var: $result
    # hashref of output data from VEP script (consequence, amino_acids,
    # sift, polyphen, etc), results of patient samples & non-cds rows
	my $result = $self->_run_vep(\%exon_data_ref);
    { # add counts, errors, etc:
        my %h = (
            variants => \%seen, # unique exon_id_aliases
            total    => scalar @$files,
            counts   => $self->result_counter, # add result counters
            errors   => $self->errors,
        );
        $result->{data} = \%h;
    }
    { # delete tmp files:
        io($self->vep_input)->unlink || die "cannot unlink vep_input - $!";
        io($_)->unlink for @$files;
        io($tmp_dir)->rmdir || die "cannot unlink $tmp_dir = $!";
    }
	return $result;
}

#-------------------------------------------------------------------------------
sub _parse_file {
    my ($self, $f) = @_; # io object

	my @rows = io($f->name)->slurp; # warn Dumper \@rows;
    
	my @data = (); # for AoH
	ROW: for (@rows) {
		next ROW if /^#/; # skip comments
		$self->result_counter->{src_rows}++;

        my @fields = split "\t", $_;
        my $vals = $self->_parse_fields(\@fields) || next ROW; # $vals = hashref
        push @data, $vals;
	}    
    $self->result_counter->{accepted_src_rows} += scalar @data;
    return \@data;
}

#-------------------------------------------------------------------------------
sub _parse_fields {
    my $self = shift;
    my $data = shift; # arrayref of tab-separated vcf row entries

    return 0 unless $data->[0] =~ /^chr/; # or rest of regexes will fail
    
	my $chr     = $data->[0]; # warn $chr; # eg chrX, chr2, etc
    my $pos     = $data->[1]; # warn $pos; # numerical position
	my $ref     = $data->[3]; # warn $ref; # str of 1 or more A,C,T,G bases
	my $alt     = $data->[4]; # warn $alt; # str of 1 or more A,C,T,G bases
    my $info    = $data->[7]; # warn $info # DP, TI, GI, FC, GT, etc values
	my $results = $data->[9]; # warn $results; # colon-separated results (eg VF)

	my $vf = (split ':', $results)[3] || warn 'no VF info'; # warn $vf;
    
    my $known_locations_map = $self->known_locations;

	my ($depth) = $info =~ /DP=(\d+)/; # warn $depth;
    my ($genes) = $info =~ /GI=(.*?)\;/; # warn $genes; # non-greedy match
    my $allele  = undef; # defined in block below
    
    # rules: exclude if start position matches exclusion list, depth < 100 or
    # VF < 5% (unless start position matches inclusion list):
    unless ( $known_locations_map->{include}->{$pos} ) {
        return 0 if
            $vf < 0.05 || $depth < 100 || $known_locations_map->{exclude}->{$pos}
    }

    # define initial start & end positions = vcf 'position' var (2nd col):
    my $start_pos = my $end_pos = $pos;

    # define allele and refine start & end positions depending on ins/del/sub:        
    if ( length $alt > 1 ) { # warn 'insertion'; # base insertion:        
        $start_pos += 1; # end pos stays same
        $allele = sprintf '-/%s', substr($alt, 1); # alt minus 1st base
    }
    elsif ( length $ref > 1 ) { # warn 'deletion'; base deletion:
        $start_pos += 1;
        $end_pos += length($ref) - 1;
        $allele = sprintf '%s/-', substr($ref, 1); # ref minus 1st base
    }
    else { # warn 'substitution'; # alt & ref both single ie base substitution:
        $allele = sprintf '%s/%s', $ref, $alt; # warn $allele;
    }

    my @genes = do { # remove duplicate genes: eg TP53,TP53,TP53
        no warnings 'uninitialized'; # eg if regex failed due to malformed str
        my %seen = map { $_ => 1 } split ',', $genes;    
        keys %seen;
    }; # warn @genes;
    my $gene = join ', ', @genes; #  || warn 'no GI entry';
    
    my %h = (
        chromosome  => substr($chr, 3), # remove leading 'chr' chars
        start_point => $start_pos,
        end_point   => $end_pos,
        allele      => $allele,
        depth       => $depth,
        gene        => $gene,
        vf          => $vf * 100, # convert proportion to percent
    ); # warn Dumper \%h;

=begin # not using gene_strand table - all strands '+'
    GENE: for my $gene (@genes) {
        # + or - strand from gene_strand table:
        my $strand = $gene_strand->{$gene};
        unless ($strand) {
            warn "$gene not in gene_strand table";
            next GENE;
        } # warn Dumper [ $chromosome, $start_pos, $end_pos, $allele, $strand ];
        $h{strand} = $strand;
    }
=cut
    $h{strand} = '+'; # not using gene_strand table
    return \%h;
}

#-------------------------------------------------------------------------------
sub _run_vep {
    my $self = shift;

    # var: $exon_data_ref
    # hash map; keys = unique_id (chromosome:start-base, eg 2:123456); vals =
    # @vep_field vals (chr, start, end, etc); acts as ref data for merging with
    # VEP script output
	my $exon_data_ref = shift; $self->_debug(['exon_data_ref',$exon_data_ref]);

    # var: $vep_input
    # full path to vep input file
	my $vep_input_filename = $self->vep_input; # warn $vep_input_filename;

    # var: @results
    # container to hold tab-delimited results array from vep output
	my @results;

=begin # this block handles separate chromosome vep input files:
my @opts = ( "-config=$Bin/../script/vep.ini" );
for my $chr( 1 .. 23, 'X') {
    my $src = join '_', $self->vep_input, $chr; 
    next unless -e $src;

    # open pipe to vep script (input = $vep_file; output = stdout):
	my $io = io->pipe("$vep_script @opts -i=$src"); # use IO::Detect; warn is_filehandle($io);
	while ( my $line = $io->getline ) { # warn $line;
		push @results, $line;
	}  $self->_debug(['vep output',\@results]); # warn Dumper \@results;
}
=cut

    # load opts from vep.ini + user-selected options to augment:
    my @opts = ( "-config=$Bin/../script/vep.ini", "-i=$vep_input_filename" );
    { # enabled forking on deployment server (actually slower on dev; see 'top'):
        my $forks = $self->config->{fork}; # warn Dumper $forks;
        push @opts, "--fork=$forks" if $forks; # development.ini = 0
    } # warn Dumper \@opts;
    
    my $user_opts = $self->_get_form_options;
    push @opts, @$user_opts; # warn Dumper \@opts;
#	warn Dumper io('/tmp/data.vep')->slurp; # from test scripts

    # open pipe to vep script (input = $vep_file; output = stdout):
	my $io = io->pipe("$vep_script @opts"); # use IO::Detect; warn is_filehandle($io);

# start vep input ==============================================================
    my $t0 = [gettimeofday]; # set t0
	while ( my $line = $io->getline ) { # warn $line;
		push @results, $line;
	}  $self->_debug(['vep output',\@results]); # warn Dumper \@results;
    $self->result_counter->{runtime} = tv_interval $t0, [gettimeofday]; # script runtime
# end vep input ================================================================

    # var: @input_fields
    # list of data items from $exon_data_ref which are needed for adding to VEP output
    my @input_fields = qw(exon_id chromosome start_point end_point);

    # var: @vep_data
    # array of composite of vep input & vep output data
    my @vep_data;

    # var: %seen
    # running tally of vep inputs with 1 or more results
    my %seen;

    RESULT: for (@results) { # warn Dumper $_;
        next RESULT if /^#/; # skip comment lines
        my @cols = split /\t/; # warn Dumper \@cols;

        # var: $vep_exon_id
        # unique identifier - 1st col of vep output - in same format as
        # %$exon_data_ref key (eg 1_123456_C/T)
        my $vep_exon_id = $cols[0]; # warn $vep_exon_id;

        # var: $ref
        # $exon_data_ref hashref for $vep_exon_id (start, end, chr, allele, etc)
        if ( my $ref = $exon_data_ref->{$vep_exon_id} ) { # warn Dumper ['ref',$ref];
            $seen{$vep_exon_id}++; # vep input file has at least one result

            # capture vep cols: consequence, amino_acids, existing_variation, extra:
			my $extra = $cols[13]; # contains sift, polyphen, etc results
			# extract sift & polyphen into separate cols:
			my $sift_and_polyphen = $self->_prediction_and_score($extra);
            # merge sift & polyphen data with allele, consequence, amino_acids, s + p:
            my @output_data = ( @cols[2, 3, 4, 6, 8, 9, 10, 12], @$sift_and_polyphen );
            # combine vep input data (chr, start, end, exon_id) with vep output data
			# (sift, polyphen data, consequence, allele, etc):
            push @vep_data, [ @{$ref}{@input_fields}, @output_data ];

			{
				my %h = (
					consequence => $cols[6],
					existing    => $cols[12],
					polyphen    => $sift_and_polyphen->[1],
					exon_id		=> $ref->{exon_id},
					sift 		=> $sift_and_polyphen->[0],
				); # warn Dumper \%h;
				{ # check location infos match before merging:
					my $vep_location = $cols[1]; # warn $vep_location;
                    my ($start, $end) = @{$ref}{ qw/start_point end_point/ };
                    my $loc = do {
                           if ( $end < $start ) { join '-', $end, $start } # insertion
                        elsif ( $end > $start ) { join '-', $start, $end } # deletion
                        else  { $start } # substitution                    
                    }; # warn $loc;

					my $ref_location = sprintf '%s:%s', $ref->{chromosome}, $loc;
                        # warn Dumper [$vep_location,$ref_location];
    
					unless ( $vep_location eq $ref_location ) {
                        my $str = sprintf 'vep location (%s) != ref_location (%s)',
                            $vep_location, $ref_location;
                        $self->_add_to_errors($str); # warn $str;
                    }
				}
				# merge %h with $exon_data_ref entry for $vep_exon_id:
                map $exon_data_ref->{$vep_exon_id}->{$_} = $h{$_}, keys %h;
			}

			# var: $sample_data
			# sample data hashref from exon_data_ref for chr_location
			if ( my $sample_data = $ref->{sample_data} ) { # arrayref
				# examines vep consequence & existing_variation cols to determine
				# whether to use vep result for analysis of sample_data
				my $is_required = _want_vep_result(\@cols); # returns 1 or 0

				for (@$sample_data) {
					$_->{vep_row_count}++; # for vep_exon_id freq. in VEP results
					# flag to indicate whether to use result (multiple overwrites OK):
					$_->{use_vep_result} = $is_required; # 1 or 0
				}
			} # warn Dumper $ref->{sample_data};
		}
        else { warn "no match in src file for $_" } # no match in src file
    } $self->_debug(['post VEP exon_data_ref', $exon_data_ref]);

    # has no vep result:
    my @orphans = sort by_chr_location
        map $exon_data_ref->{$_}, grep { ! $seen{$_} } keys %$exon_data_ref;

	# var: $samples
	# process sample_data in $exon_data_ref
	my $samples = $self->_process_sample_results($exon_data_ref); # returns hashref

	return {
		exon_ref => $exon_data_ref,
		vep_data => \@vep_data,
		non_cds  => \@orphans,
		samples  => $samples,
	}
}

#-------------------------------------------------------------------------------
sub _prediction_and_score {
	my ($self, $str) = @_; # warn $str;

    # regex to capture prediction and/or score eg SIFT=deleterious(0.02);
    #  PolyPhen=probably_damaging; SIFT=0.002: / (\w+)? ( \(? [\d\.]+ \)? )? /x
    my $re = qr/
        (\w+)?  # optional 'prediction' (eg benign, deleterious, etc)
        (       # start of optional 'score'
            \(?     # optional open bracket (only if prediction AND score selected)
            [\d\.]+ # any number of 0-9 & decimal point chars (eg 0.012)
            \)?     # optional close bracket (only if prediction AND score selected)
        )?      # end of optional 'score'
    /x;

	# need to return expected number of elements for tt:
	my $opts = $self->form_opts; # check for sift & polyphen

	my @results; # capture in order 'sift', 'polyphen' to match expected order in tt:
	if ( $str =~ /sift=($re)/i ) {
		push @results, $1; # warn $sift;
	}
	elsif ( $opts->{sift} ) { push @results, undef } # to populate td for tt

	if ( $str =~ /polyphen=($re)/i ) {
		push @results, $1; # warn $poly;
	} # warn Dumper \@results;
	elsif ( $opts->{polyphen} ) { push @results, undef } # to populate td for tt

=begin # combined, but doesn't work - gets killed
	while ( $str =~ /(?:sift|polyphen)=($re)/ig ) { # don't capture words
		push @results, $1; # warn $1;
	}
=cut
	map { # remove captured items within $re from $str:
		my $quoted = quotemeta $_; # warn $quoted;
		$str =~ s/(sift|polyphen)=$quoted(;?)//i; # remove trailing semi-colon
	} grep $_, @results; # warn $str; # !! grep $_ or empty vals cause problems

	push @results, $str; # what's left of it (non-sift, non-polyphen 'extra')

	return \@results;
}

#-------------------------------------------------------------------------------
sub _process_sample_results {
	my ($self, $data) = @_; # warn Dumper $data;

	my %h;
	while ( my($location, $d) = each %$data ) {
		if ( my $sample_data = $d->{sample_data} ) { # warn Dumper $sample_data;
            # $sample_data is array(ref):
			for my $ref (@$sample_data) { # warn Dumper $ref;
				# transform $hmds_ref '/' to '_' for automatic tt sorting:
				my $lab_no = join '_', reverse split '/', $ref->{lab_no};
				$ref->{hmds_ref} = $lab_no; # warn $lab_no;

				if ( $ref->{use_vep_result} ) {
					push @{ $h{match}{$lab_no}{$location} }, $ref;
					$self->result_counter->{matches}++;
				}
				else {
					push @{ $h{no_match}{$lab_no}{$location} }, $ref;
					$self->result_counter->{no_match}++;
				}
            }
		}
	} $self->_debug('sorted_sample_results', \%h); # warn Dumper \%h;
	return \%h;
}

#-------------------------------------------------------------------------------
sub by_hmds_ref {
	my ($r1, $y1) = split '/', $a; # warn Dumper [$r1, $y1];
	my ($r2, $y2) = split '/', $b; # warn Dumper [$r2, $y2];

	return $y1 <=> $y2 || $r1 <=> $r2;
}

#-------------------------------------------------------------------------------
sub _want_vep_result { # caller wants 1 or 0 return val (not undef):
	my $cols = shift; # arrayref

	my $consequence = $cols->[6]; # warn Dumper [ @{$cols}[6,12] ];
	my $variation   = $cols->[12];

    return 1 if (
        $variation =~ /COSM/ # want these regardless of consequence
        # reject if 'synonymous_variant', accept if variation matches /TMP|^-:
        || ( $variation =~ /TMP|^-/ && $consequence ne 'synonymous_variant' )
    );
	return 0; # don't want it

#	return 1 if $variation =~ /COSM/; # want these regardless of consequence
#	return 0 if	$consequence eq 'synonymous_variant'; # don't want these
#	return ( $variation =~ /TMP|^-/ );
}

#-------------------------------------------------------------------------------
sub _get_hmds_refs {
	my ($self, $header) = @_; # warn Dumper $header; # arrayref of hmds refs (in pairs)

	my $i = 0; # counter
	my @refs;

	# for cols 6 to last take the 1st col of each pair and extract lab_no:
	# $#{$header} = same as (scalar @array - 1)
	for ( @$header[5 .. $#{$header} - 1] ) { # warn Dumper [$_, $i];
		next if $i++ % 2; # increment then test for modulus 2 - get every other col
		if ( my ($ref) = $_ =~ m!(\d+/\d{2})! ) {
			push @refs, $ref;
		}
		else {
			my $str = sprintf q!cannot find lab number in col header '%s'!, $_;
			$self->_add_to_errors($str);
		}
	} # warn Dumper \@refs;
	return \@refs;
}

#-------------------------------------------------------------------------------
sub _get_form_options { # user submitted opts (eg sift, polyphen, etc)
    my $self = shift;

    my $params = $self->form_opts; # warn Dumper $form_opts;

    # default db is 'core', refseq passed by form selection if required:
    my $transcript_db = $params->{refseq} ? 'refseq' : 'core';

    my @opts = ( '--dir=/home/raj/.vep/' . $transcript_db );

    # polyphen & sift take args (s, p or b)
    push @opts, '--polyphen=' . $params->{polyphen} if $params->{polyphen};
    push @opts, '--sift='     . $params->{sift} if $params->{sift};
    # check_existing, regulatory & coding_only take no args:
    for ( qw/check_existing coding_only regulatory/ ) {
        push @opts, "--$_" if $params->{$_};
    } # warn Dumper \@opts;

    return \@opts;
}

#-------------------------------------------------------------------------------
sub _add_to_errors {
	my ($self, $str) = @_;
	push @{ $self->errors }, $str;
}

#-------------------------------------------------------------------------------
sub by_chr_location { # alphanumeric sort on chromosome 1-22, X, and start_point
    return ( # 1st sort on chromosome, then start_point:
        ( $a->{chromosome} !~ /^\d+/ || $b->{chromosome} !~ /^\d+/ )
            ? $a->{chromosome} cmp $b->{chromosome} # non-digit eg X
            : $a->{chromosome} <=> $b->{chromosome} # digit eg 1 - 22
    ) || $a->{start_point} <=> $b->{start_point};
}

#-------------------------------------------------------------------------------
sub by_chromosome_and_start_pos { # Sort::Naturally ncmp function - same as above:
    return ncmp($a->[0], $b->[0]) || ncmp($a->[1], $b->[1]);  
}

#-------------------------------------------------------------------------------
# extract tab-delimited data from csv source file:
sub _text_csv_slurp {
    my $self = shift;

    my $data = $self->src_data->content; # warn $data; # string

    my $csv = Text::CSV->new(\%text_csv_args);

    my @results;
    for ( split "\n", $data ) { # warn $_;
        if ( $csv->parse($_) ) {
            my @row = $csv->fields();
            push @results, \@row;
        }
    } # warn Dumper \@results;
    return \@results;
}

#-------------------------------------------------------------------------------
# get reference table as hashref of gene => { chromosome, start_base }:
sub _build_ref_table {
    my $self = shift;

    my $db = NGS::DB->new(); # warn $db->dbix;
    my $ref_tbl = $db->dbix->select('ref_seq', '*')
        ->map_hashes('gene'); # warn Dumper $ref_tbl;
    return $ref_tbl;
}

#-------------------------------------------------------------------------------
sub _build_known_locations {
    my $self = shift;
    
    my $db = NGS::DB->new(); # warn $db->dbix;
    my $r  = $db->dbix->select('locations', ['position', 'action']);
    
    my %h;
    while ( $r->into( my ($position, $action) ) ) {
        $h{$action}{$position} = 1;
    } # warn Dumper \%h;
    return \%h;
}

#-------------------------------------------------------------------------------
sub _build_vep_input {
	my $self = shift;

	# create new temp file for vep input data:
	my $filename = $self->form_opts->{data_src};
	$filename =~ s/(txt|zip)\Z/vep/; # .txt -> .vep
	$filename =~ s/\s/_/g; # spaces -> underscores
    
    my $path_to_file = '/tmp/'.$filename;

    # delete if already exists (eg due to aborted previous run) as using append mode:
    io($path_to_file)->unlink if -e $path_to_file;
	return $path_to_file;
}

#-------------------------------------------------------------------------------
sub _build_result_counter {
	my $self = shift;

    my %h = map +($_ => 0),
        qw( matches no_match vep_input_rows src_rows accepted_src_rows runtime );
	return \%h;
}

#-------------------------------------------------------------------------------
sub _debug { # only debugging dev server output (env added in post => '/vep' sub):
	return 0 unless DEBUG && shift->form_opts->{environment} eq 'development';
	print $debug Dumper @_;
}

=begin _build_ref_table() from ref.csv
    my $ref = "$Bin/../ref.csv";
    my $io = new IO::File;
    open( $io, '<', $ref ) || die $!;

    my $csv = Text::CSV->new(\%text_csv_args);

    my %h;
    while ( my $row = $csv->getline( $io ) ) {
        my ($ref_seq, $chr, $start) = @$row;
        $h{$ref_seq} = {
            chromosome => $chr,
            start_base => $start,
        };
    } # warn Dumper \%h;

    return \%h;
=cut

1;